Tuesday, August 6, 2019
Epidermic cell observation Essay Example for Free
Epidermic cell observation Essay The sample of epidermal cells were taken from two onions instead of one onion (layer 6-10 from the first onion, layer 1-4 from the second onion) due to the time limit of experiment which may cause an inconsistency in raw data because the two onions are slightly different in preserved temperature, shape, and growing environment. When cell samples were taken from the second onion, some of the cells are frozen due to the preservation which causes a distortion of the shape of the cells and may result in errors of counts. Because of the time limit of this experiment, there is a limitation in the size of samples. When counting the cells, there is no strict rule on regarding or disregarding part of a cell. The researcher estimated the number and may cause an error in counting. The standard deviation is much smaller than one third of each mean, and gives the data more reliability The exponential function does not fit the means well enough that for layer 9, 6, 5, 3, 2, 1, the value according to the function is not included in the range of the mean plus or minus the standard deviation. Possible improvements Use consistently one onion for the experiment. Preserve the samples with restricted conditions. (Preserved time, temperature, moisture) Collect more samples. Restrict the proportion of length that a cell has in the range of scope to be regarded in the counting.
Monday, August 5, 2019
Genetic Diversity and QoI Fungicide Resistance
Genetic Diversity and QoI Fungicide Resistance Study of genetic diversity and QoI fungicide resistance in frogeye leaf spot (Cercospora sojina) from Tennessee Introduction Frogeye leaf spot (FLS) of soybean (Glycine max Merr.), caused by the fungal pathogen C. sojina Hara, was first identified in Japan in 1915 and South Carolina, the United States in 1924 (Lehman 1928; Phillips 1999). FLS is an important foliar disease of soybean although symptoms can appear on stems, pods, and seeds. There has been no report of the alternative host in other crops or weeds (Mian et al. 2008). Initial symptom appears as small, light brown circular spot which is later surrounded by darkish brown to reddish circle. (Dashiell and Akem 1991). As the leaves are covered with 50% lesions, leaves start to blight wither and finally falls prematurely. On the lower surface of leaves, the central spot of lesions is somewhat grayish because of conidia produced on conidiophores. Conidia are a primary and secondary source of inoculum and are produced in infected leaves, stems, and pods. Warm temperature and frequent rainfall are suitable factors for severe disease, and fully expanded leaves are more resistant with small lesions as compared to younger leaves (Phillips 1999). The United States is the leading producer of soybean in the world. According to the food and agriculture organization (FAO), the US produced 108 million metric tons of soybeans, second only to corn in 2014 (http://faostat3.fao.org/). FLS is an important disease in most of the soybean growing countries in the world and the main factors hindering the yield includes a reduction in photosynthetic area and premature defoliation of leaves (Mian et al. 2008; Wrather et al. 2010). In the US, FLS is significantly present in Southern warm and humid regions (Mian et al. 2008; Yang et al. 2001). Now, C. sojina is also important to Northern states as the disease was reported in Iowa in 1999, Wisconsin in 2000 (Mengistu et al. 2002) and Ohio in 2006 (Cruz and Dorrance 2009). The damage caused by FLS depends on soybean cultivars and locations, and yield loss has been reported from 10% to more than 60% (Dashiell and Akem 1991; Hartwig and Edwards Jr 1990; Laviolette et al. 1970; Mian et al. 1998). FLS is a polycyclic disease and the disease remains active throughout the growing season (Kim et al. 2013; Laviolette et al. 1970). Dispersal of conidia to some distance is favored by the wind and water splashes (Laviolette et al. 1970). Mycelium of C. sojina can overwinter and a report suggests potential survival of the pathogen in the plant debris for two years (Zhang and Bradley 2014). There are several FLS control methods including cultural practices, use of fungicides and genetic resistance. Primarily, genetic resistance is a most effective measure to control FLS. Till now, three resistant genes Rcs (Resistant to C. sojina), have been deployed: Rcs1 (Athow and Probst 1952), Rcs2 (Athow et al. 1962) and Rcs3 (Phillips and Boerma 1982). The Rcs3 gene confers resistant against race 5 and all known races of C. sojina present in the USA. (Mengistu et al. 2012; Phillips and Boerma 1982). Similarly, crop rotation for two years has been suggested to skip viable inoculum and prevent dise ase severity in the field (Grau et al. 2004; Zhang and Bradley 2014). Further, use of pathogen-free seeds and necessary application of fungicides before flowering to early pod stage have been practiced to decrease disease severity (Grau et al. 2004). Meanwhile, because of change in the pathogen, it has been proven that resistant gene can confer resistance for a certain period and there can be selection against QoI fungicides too (Athow and Probst 1952; Athow et al. 1962; Zeng et al. 2015). There has already been a report of field isolates resistant to QoI fungicides in Tennessee (Zhang et al. 2012). Control measures like use of fungicides and planting of resistant cultivars force pathogens to select against selection pressure. Studies of C. sojina using several approaches indicate diversity among isolates. Because of the lack of universally accepted soybean differentials, its hard to characterize and compare C. sojina isolates. Grau et. al. (2004) have reported 12 races of C. sojina in the US, 22 races in Brazil and 14 races in China. A new set of 12 soybean differentials and 11 races have been proposed based on the reaction of isolates collected from the USA, Brazil, and China (Mian et al. 2008). However, the reaction of 50 isolates from Ohio on the same 12 soybean differentials produced 20 different races (Cruz and Dorrance 2009). There has been a handful of research to characterize C. sojina based on molecular markers. One study includes AFLP based assessment of 62 isolates from Brazil, China, Nigeria and the United States, which showed a significant amount of genetic diversity among isolates, although genotypes did not cluster based on origin. (Bradley et al. 2012). Recently, a study of 132 isolates fr om Arkansas with simple sequence repeat (SSR) has shown the chances of sexual reproduction and high genetic diversity in C. sojina (Kim et al. 2013). The main objectives of this study were to access: genetic diversity by developing and using novel SNP markers and distribution of QoI resistant and sensitive isolates from Jackson and Milan, TN. Sample collection, Single-lesion Isolation, and DNA extraction In 2015, soybean leaves exhibiting typical symptoms of infection with FLS were collected from research plots at two locations in Tennessee (Milan and Jackson). In total, 437 isolates, 203 from Jackson and 234 from Milan, were collected from eight fungicides treated and non-treated Maturity group III soybean cultivars (Table 1). Cultivars were planted in 4 rows (30-inch row spacing), 30 ft long plots in a randomized complete block design with four replications. Plots were split, two rows were not treated, and two rows were treated at R3 growth stage (beginning pod) with Quadris Top SB at 8 fl oz/a (Azoxystrobin and Difenoconazole, Syngenta Corp., Basel, Switzerland). A single isolate of C. sojina was obtained from a single lesion from each leaf. Sporulation was induced by incubating leaves in a plastic bag with moist towels at room temperature. Spores were harvested with a flame-sterilized needle using a dissecting microscope and 8-10 spores transferred to RA-V8 agar media (rifampicin 25 ppm, ampicillin 100 ppm, 160 mL unfiltered V8 juice, 3 gm calcium carbonate and 840 mL water). Observations were made daily and contaminated sectors removed. After seven days, single-lesion isolates of C. sojina were transferred to a new V8 agar media. In addition, a set of 40 isolates from 10 different states, collected before 2015, were included in this study (Table 2). Table 1. Soybean cultivars and number of Cercospora sojina isolates recovered from treated and non-treated cultivars. Cultivar ID Cultivars Jackson Milan Total Treated Non-treated Treated Non-treated C1 VAR Armor 37-R33 RR2 17 11 21 4 53 C2 VAR Asgrow AG3832 GENRR2Y 7 15 20 14 56 C3 VAR Becks 393R4 0 0 0 3 3 C4 VAR Croplan R2C 3984 19 13 11 14 57 C5 VAR Mycogen 5N393R2 RR2 g 12 20 17 28 77 C6 VAR Terral REV 39A35 10 15 13 16 54 C7 VAR USG 73P93R 22 6 13 21 62 C8 VAR Warren Seed 3780 R2Y It 14 22 13 26 75 Table 2. Number of Cercospora sojina isolates collected from Jackson (JTN) and Milan (MTN), Tennessee in 2015 and historical isolates from various states in previous years. Location No. of Samples Year JTN 203 2015 MTN 234 2015 AL 5 2006 AR 5 2006 FL 1 2006 GA 4 2006 IA 1 2006 IL 2 2006/09 LA 1 2006 MS 6 2006 SC 2 2006/2009 TN 12 2007 WI 1 2006 Note: JTN (Jackson) and MTN (Milan) collection in 2015 in Tennessee. TN is a historical collection. For DNA extraction, the single-lesion isolates were grown in 24-well deep well plates (Fisher Scientific) with 1 mL RA-V8 liquid broth (same as above, minus the agar) per well. DNA was extracted as described by Lamour and Finley (2006). Briefly, this includes harvesting mycelium from the broth cultures into a 96-well 2 mL deep well plate pre-loaded with 3-5 sterilized 3 mm glass beads. The plates are freeze dried and the dried mycelium powdered using a Mixer-Mill bead beating device (Qiagen). The powdered mycelium was then lysed and a standard glass fiber spin-column DNA extraction completed. The resulting genomic DNA was visualized on a 1% gel and quantified using a Qubit device. SNP marker discovery and targeted-sequencing based genotyping Whole genome sequencing was accomplished for three FLS isolates from a historical collection originally compiled by Dr. Dan Philips, UGA: FLS11 (CS10117) recovered from Milan, Tennessee in 2010, FLS19 (TN10) from the Georgia Experiment Station, and FLS21 (TN85) which was recovered from Mississippi. Genomic DNA was extracted from freeze-dried and powdered mycelium using a standard phenol-chloroform approach and the resulting DNA was submitted to the Beijing Genomics Institute in China for 2100 paired-end sequencing on an Illumina HiSeq2000 device. De novo assembly, read mapping and SNP discovery was accomplished with CLC Genomics Workbench 7 (Qiagen). As there was no public reference genome available at the time, FLS21 was de novo assembled using the default settings in CLC and the resulting contigs used as a reference genome. All open reading frames (ORFs) longer than 300 amino acids were predicted using CLC and annotated onto the FLS21 contigs. The raw reads from FLS11 and FLS19 wer e then mapped to the draft reference (separately), and putative single nucleotide variants (SNVs) identified at sites with at least 20X coverage and an alternate allele frequency greater than 90%. A subset of the SNVs was chosen from the largest contigs for further genotyping using a targeted sequencing approach. Custom Perl scripts were used to extract the flanking sequences for the panel of SNPs and primers were designed using BatchPrimer3 v1.0 (http://probes.pw.usda.gov/batchprimer3/) to amplify targets between 80 and 120bp in length. Primers for 50 SNPs including mitochondrial QoI resistant locus are summarized in Table 3. Primer sequences and genomic DNA were sent to Floodlight Genomics (Knoxville, TN) for processing as part of a non-profit Educational and Research Outreach Program (EROP) that provides targeted-sequencing services at cost for academic researchers. Floodlight Genomics uses an optimized Hi-Plex approach to amplify targets in multiplex PCR reactions and then sequences the resulting sample-specific amplicons on either an Illumina or Ion NGS device. Resulting sample-specific sequences were mapped to the reference contigs and genotypes assigned for loci with at least 6X coverage. QoI resistant locus genotyping A single nucleotide polymorphism (G/C) in the Cytochrome b gene of the C. sojina mitochondrial genome has been shown to confer resistance to QoI fungicides. A custom TaqMan SNP genotyping assay will be designed using the online design tools from Applied Biosystems (Thermo Scientific) and include the forward primer GGGTTATGTTTTACCTTACGGACAAATG and reverse primer GTCCTACTCATGGTATTGCACTCA and two probes to discriminate resistant and sensitive isolates: ACTGTGGCAGCTCATAA with VIC for the C resistance allele and ACTGTGGCACCTCATAA with FAM for the G sensitive allele (Zeng et al. 2015). Quantitative PCR (qPCR) will be accomplished based on manufacturer instruction using the QuantStudio 6 Flex Real-time PCR System (Thermo Fisher Scientific Inc.). Mating types determination A previously described multiplex PCR assay will be used to assign mating type (MAT1-1-1 or MAT1-2) to a subset of the isolates that had unique multi-locus SNP genotypes (Kim et al. 2013). The MAT1-1-1 locus will be amplified with CsMat1f (5 TGAGGACATGGCCACCCAAATA) and CsMat1r (5 AAGAGCCCTGTCAAGTGTCAGT) and the Mat1-2 locus will be amplified with CsMat2f (5 TGTTGTAGAGCTCGTTGTTCGCA) and CsMat2r (5 TCAGACCTTATGAGCTTGAAAGTGCT) primers (Kim et al. 2013). The assay will be included with the ITS5 (5 GGAAGTAAAAGTCGTAACAAGG) and ITS4 (5 TCCTCCGCTTATTGATATGC ) primers as an internal control to amplify the internal transcribed spacer (ITS) region (White et al. 1990). The resulting PCR products will be visualized under UV light on 2% agarose gel stained with GelRed (Phenix Research Products) and scored based on fragment size of MAT1-1-1 (405 bp) and Mat1-2 (358 bp). Data Analysis SNP loci for each sample will be combined to form a multi-locus SNP genotypes and samples with identical genotype (clonal lineages) will be clone corrected. To assess population structure among the two locations (and in relation to the historical isolates), Bayesian clustering will be accomplished using Structure 2.3.4 (Pritchard et al. 2000). Structure Harvester (Earl 2012) will be used to find the most probable value of K from the results obtained from Structure analysis. Principle coordinate analysis, AMOVA, Nei pairwise genetic distance, Nei pairwise genetic identity and genetic indices will be analyzed with GENALEX (Peakall and Smouse 2006). Phylogenetic clustering of the unique genotypes will be accomplished using Mega 6.06 (Tamura et al. 2013). Minimum spanning networks (Bandelt et al. 1999) will be constructed with PopART (http://popart.otago.ac.nz/). Expected Results Novel SNP markers will be developed and assayed in C. sojina isolates. Population study will help to determine if the isolates from two locations are sub-grouped. The genetic study will also accesses genetic diversity present within and among populations. Molecular identification of mutated cytochrome b site will help to determine the distribution of resistant isolates and contribute to compare resistant isolates in fields between two different time periods. Study of two different mating types in population will help to predict sexual reproduction. References Athow K and Probst AH. 1952. The inheritance of resistance to frog-eye leaf spot of Soybeans. Phytopathology 42(12):660-662 pp. Athow KL, Probst AH, Kurtzman CP and Laviolette FA. 1962. A newly identified physiological race of Cercospora sojina on soybean. Phytopathology 52(7):712-714 pp. Bandelt H-J, Forster P and RÃ ¶hl A. 1999. Median-joining networks for inferring intraspecific phylogenies. Molecular biology and evolution 16(1):37-48. Bradley C, Wood A, Zhang G, Murray J, Phillips D and Ming R. 2012. Genetic diversity of Cercospora sojina revealed by amplified fragment length polymorphism markers. Canadian Journal of Plant Pathology 34(3):410-416. Cruz C and Dorrance A. 2009. Characterization and survival of Cercospora sojina in Ohio. Plant Health Progress doi 10. Dashiell K and Akem C. 1991. Yield losses in soybeans from frogeye leaf spot caused by Cercospora sojina. Crop Protection 10(6):465-468. Earl DA. 2012. STRUCTURE HARVESTER: a website and program for visualizing STRUCTURE output and implementing the Evanno method. Conservation genetics resources 4(2):359-361. Grau CR, Dorrance AE, Bond J and Russin JS. 2004. Fungal diseases. Soybeans: Improvement, production, and uses(soybeansimprove):679-763. Hartwig E and Edwards Jr C. 1990. The uniform soybean tests, southern region, 1989. USDA Mimeographed Rep. US Gov. Print. Office, Washington, DC. Kim H, Newell AD, Cota-Sieckmeyer RG, Rupe JC, Fakhoury AM and Bluhm BH. 2013. Mating-type distribution and genetic diversity of Cercospora sojina populations on soybean from Arkansas: Evidence for potential sexual reproduction. Phytopathology 103(10):1045-1051. Laviolette F, Athow K, Probst A, Wilcox J and Abney T. 1970. Effect of bacterial pustule and frogeye leafspot on yield of Clark soybean. Crop science 10(4):418-419. Lehman S. 1928. Frog-eye leaf spot of Soy Bean caused by Cerco-spora diazu Miara. Journal of Agricultural Research 36(9):811-833. Mengistu A, Bond J, Mian R, Nelson R, Shannon G and Wrather A. 2012. Resistance to Frogeye Leaf Spot in selected soybean accessions in MG I through MG VI. Plant Health Progress 10. Mengistu A, Kurtzweil NC and Grau CR. 2002. First report of Frogeye Leaf Spot (Cercospora sojina) in Wisconsin. Plant Disease 86(11):1272-1272. Mian M, Boerma H, Phillips D, Kenty M, Shannon G, Shipe E, Blount AS and Weaver D. 1998. Performance of frogeye leaf spot-resistant and-susceptible near-isolines of soybean. Plant disease 82(9):1017-1021. Mian M, Missaoui A, Walker D, Phillips D and Boerma H. 2008. Frogeye Leaf Spot of Soybean: A review and proposed race designations for isolates of Hara. Crop science 48(1):14-24. Peakall R and Smouse PE. 2006. GENALEX 6: genetic analysis in Excel. Population genetic software for teaching and research. Molecular ecology notes 6(1):288-295. Phillips D. 1999. Frogeye leaf spot. Compendium of soybean diseases, 4th ed. American Phytopathological Society Press, St. Paul, MN:20-21. Phillips D and Boerma H. 1982. Two genes for resistance to race 5 of Cercospora sojina in soybeans. Phytopathology 72(7):764-766. Pritchard JK, Stephens M and Donnelly P. 2000. Inference of population structure using multilocus genotype data. Genetics 155(2):945-959. Tamura K, Stecher G, Peterson D, Filipski A and Kumar S. 2013. MEGA6: molecular evolutionary genetics analysis version 6.0. Molecular biology and evolution:mst197. White TJ, Bruns T, Lee S and Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR protocols: a guide to methods and applications 18(1):315-322. Wrather A, Shannon G, Balardin R, Carregal L, Escobar R, Gupta G, Ma Z, Morel W, Ploper D and Tenuta A. 2010. Effect of diseases on soybean yield in the top eight producing countries in 2006. Plant Health Progress doi 10:2008-2013. Yang X, Uphoff M and Sanogo S. 2001. Outbreaks of soybean frogeye leaf spot in Iowa. Plant Disease 85(4):443-443. Zeng F, Arnao E, Zhang G, Olaya G, Wullschleger J, Sierotzki H, Ming R, Bluhm B, Bond J and Fakhoury A. 2015. Characterization of quinone outside inhibitor fungicide resistance in Cercospora sojina and development of diagnostic tools for its identification. Plant Disease 99(4):544-550. Zhang G and Bradley CA. 2014. Survival of Cercospora sojina on soybean leaf debris in Illinois. Plant Health Prog 10. Zhang G, Newman M and Bradley C. 2012. First report of the soybean frogeye leaf spot fungus (Cercospora sojina) resistant to quinone outside inhibitor fungicides in North America. Plant Disease 96(5):767-767.
Sunday, August 4, 2019
Cuban Situation :: Cuba Politics Economy Economics Essays
Cuban Situation Cuba needs cows. In January of 2004, a Cuban delegation visited Florida to inspect beef and dairy cows to repair Cubaââ¬â¢s languishing cattle industry. Moreover, under the auspices of the U.S. Trade Sanctions Reform and Export Enhancement Act in 2000, the United States exported $350 million dollars worth of American agriculture products to its island neighbor in 2000 (Bussey 1). This budding trade relationship is symptomatic of a broader move by Cuba to fully re-insert itself in the global economy. Deprived of the protective cocoon of Soviet trade agreements and faced with economic crisis and stagnation, Cubaââ¬â¢s leaders have responded with limited economic reforms. It is clear, however, that Cuba will not emulate the rapid liberalization of much of Eastern Europe and Latin America. A brief review of Cubaââ¬â¢s economic performance since the fall of the Soviet Union reveals a trend of liberalization bred of necessity. Nevertheless, the mixed performance of the Export-Pro cessing Zones and the governmentââ¬â¢s grudging acceptance of tourism reveal a tension between Cubaââ¬â¢s need for foreign currency and direct foreign investment and a desire to insulate and preserve Cubaââ¬â¢s existing domestic apparatus. This tension underlies Cubaââ¬â¢s ongoing economic transition and has prevented wholesale market liberalization. Cubaââ¬â¢s future movement towards market reforms will be carefully managed by the Castro government to protect Cubaââ¬â¢s revolutionary legacy and to maintain control of political opposition. The fall of the Soviet Union devastated the Cuban economy. Cubaââ¬â¢s GDP contracted by 35-50% from 1989-1993 (LeoGrande quest 5). As a percentage of total Cuban trade, the Soviet Unionââ¬â¢s share fell from 66% in 1990 to 15% in 1994 (5). Moreover, Russia reneged on its oil agreement, and fitful exports caused energy shortages in Cuba. Production and consumption plummeted. From 1986-1991, Castro undertook a rectification campaign to stabilize the economy as the Soviet Union decreased its support and eventually collapsed. The plan ââ¬Å"focused on re-centralizing economic planning authority, dismantling the [Soviet-sponsored socialist management system] and market mechanisms, abolishing the free farmers markets launched in 1980, and combating corruptionâ⬠(4). In addition, Castro tried to address the massive trade imbalance by reducing imports and reinvigorating the export sector. This program was a resounding failure. More domestic and far-reaching reforms were necessary to save the economy from crisis. Economic disaster had erected a serious challenge to Cubaââ¬â¢s socialist program. In 1991, Castroââ¬â¢s announcement of a ââ¬Å"Special Period in a Time of Peaceâ⬠marked the beginning of Cubaââ¬â¢s new era of liberalization.
Saturday, August 3, 2019
Middle Childhood Essay -- Child Development, Early Childhood
A. Freeze Tag, is another variation of the game Tag. Where the person who is ââ¬Å"itâ⬠tags everyone but instead of being out of the game once tagged, the person will be frozen in place until another player ââ¬Å"un-freezeâ⬠the player, for instance by touching the frozen player on the shoulder. Freeze tag, first begins by gathering a group of players, deciding on who is ââ¬Å"itâ⬠, determining this may be volunteering oneself or playing a game like rock, paper, scissor. After determining the person who is ââ¬Å"itâ⬠, he or she will count up to a number allowing the other players to scatter, giving them enough time to get away from the person who is ââ¬Å"itâ⬠. When the person is finish counting, he/she will chase others to tag, once they are tagged; the person is frozen in place. The only way to unfreeze them is when another player touches them. The object of the game is for the person who is ââ¬Å"itâ⬠to freeze everyone in the game and the last p erson to be tagged is the next to become ââ¬Å"itâ⬠in the next game. Freeze Tag age range, when children start playing and understanding the rules of freeze tag would be from age 5-8. B: Cognitive During the transaction from early childhood towards middle childhood, not only is there evidence of physical change but also mental change in children. In 1996 Janowsky & Carper, and Sowell et al.,(2007), noted the increase of myelination in the frontal cortex, allowing further development of mental development, for instance the increase focus of attention, able to solve complex problems, planning and also ability to reflection upon their actions (Lightfoot, pg393). In the game Freeze Tag, when a child is ââ¬Å"frozenâ⬠after being touch by the person who is ââ¬Å"itâ⬠another child might lead the person who is ââ¬Å"itâ⬠towards them allowing a... ... that one is exercising and just enjoying while having fun. Itââ¬â¢s also a stress release from the pressures and expectation of the outside world, being only focus only on the short fast period of time. Older children would probably show the same excitement of when they first started playing the game Freeze Tag. Having more self control when frozen and more of a concrete focus on mental operation and strategy. Freeze Tag at any age would bring back a feeling of nostalgia to people who are playing, a feeling of being stress free and just focusing on the goal of the game. That just involves playing with a group of people until they get tired of playing. Freeze Tag starts from when you can understand and comply with the rules until determining that you have no more energy to keep up, itââ¬â¢s basically an ageless game that will continue for many generations of children.
Friday, August 2, 2019
A Psychological Profile Of Holden Caufield :: essays research papers fc
Thesis: Holden Caufield is a hostile, negatively charged character that suffers from depression which stems from a desire not to grow up and a lack of closure in his brothers death."If you really want to hear about it, the first thing you'll probably want to know is where I was born, and what my lousy childhood was like . . . "(pg. 1) These first words that Holden Caufield communicates during his tell of events that brought him to his breakdown, show the pent up hostility that still lingers. This pattern of speech, the constant expression of negativity, is a character trait of Holden that shows his inner anguish. Holden also feels a continual need for affirmation of what he just said with phrases such as, "He really would."(pg. 25) or "It really isn't." (Pg. 89) This continual need for approval shows a lowered level of self-assurance. This lowered self-assurance probably stems from his self-awareness that he is an unreliable source. The reason he is unreliable is due to his deceitful narrative of occurrences. This is seen repeatedly as Holden builds an individual up as good or righteous such as Stradlater, (pg. 25) then tears him down later. (pg 43) This inability to give truthful accounts of individuals could stem from his constant digression from the point at hand. Holden freely admits to this trait on page 183 when he says "The trouble with me is, I like it when somebody digresses. It's more interesting and all.""Certain things they should stay the way they are. You ought to be able to stick them in one of those big glass cases and just leave them alone."(pg. 122) This phrase Holden made while discussing how things were different each time he went to the museum, stems from an inability to accept that he must grow up. The thought of growing up has driven Holden into bouts of depression as inhis discussion on page 133, " It'd be entirely different. I said. I was getting depressed as hell again." This nonconformist desire has led Holden to have illusions of grandeur as a fictional savior, "The Catcher in the Rye."(pg. 173) The catcher in the rye is undoubtedly a metaphor, for keeping children from falling into the same norm as adults. The inability of Holden to accept growing up and the depression caused by it has made Holden suicidal, "what I really felt like, though, was committing suicide.
Pike by Ted Hughes Essay
Envisage the Yin and Yang emblem. The idea behind it is that there is no such thing as purity. You canââ¬â¢t have pure evil ââ¬â there is an element in all things of some good, however small. Similarly, you canââ¬â¢t have pure goodness ââ¬â there is an element in all things good that is itself bad. We see the idea in great poems like Chinua Achebeââ¬â¢s ââ¬Å"Vulturesâ⬠and in our day to day actions as member of a fickle and capricious human race. This is the idea of Pike. It is attempting to demystify; debunk a stereotype. Itââ¬â¢s kind of like a love poem to what many consider a hideous animal ââ¬â such is Hughesââ¬â¢s awe and veneration of the creature. Hughes more than anything else is trying to make us realise the beauty of the pike, its power, its wonder, its awesomeness and its importance, to both him and us. Donââ¬â¢t get put off by its size ââ¬â if you break down Hughesââ¬â¢ Pike into logical sections, then this poem will make perfect sense. The basic shape is an exploration of identity in stanzas 1-4; personal experience in 5-7; and in stanzas 8-11, a shift in and reassertion of the pikeââ¬â¢s power. The primary idea behind Pike is pike: the beauty of pike, the malevolence of pike, and Hughes essentially tries to communicate how in one simple, often overlooked animal exist two profundities of existence, the good and the bad. There is beauty in how it moves, how it lives, how it is made ââ¬â beauty in its power and sense of threat. The first 4 stanzas basically give us this paradox and underpinning this is Hughesââ¬â¢ sense of awe and disbelief. The tone is quiet, appreciative, impersonal ââ¬â as if a connoisseur appreciating and marvelling over the contradictions of such an animal. Stanzas 5-6 shift and give a personal account of Hughes trying to keep them as pets, to no avail, and linking his experience to the gruesome aggressiveness he seems to have witnessed in the wild in stanzas 6-7. These animals are fearsome, programmed to be killers, and intolerant even of each other. Though the images are more grim and violent, there is no sense of judgement ââ¬â at worst its detached and neutral; at best, even within its informative tone, there is a sense of admiration: for its power, for its solitariness; for its authenticity to itself. Stanzas 8-11 suddenly expand outwards, and return us to a personal experience ââ¬â Hughes fishing in an ancient pond, fishing for pike that he imagines to be as ancient as the monks that created it, as ancient as the idea of England itself. And as he fishes for the pike, we get a sense of reversal ââ¬â the poet, who spoke so convincingly of his expertise, experience and veneration for the animal for so much of this poem, may have narratorial power (after all, it is he who controls the poem ââ¬â the pike is the object of Hughesââ¬â¢ gaze), but in reality, he possesses none ââ¬â he is nothing more than potential prey for the violent fish. The final stanzas see a defined emotional shift to one founded upon a sense of uncertainty, of vulnerability ââ¬â how he is decidedly a target for the predator. However, you get the sense that Hughes wouldnââ¬â¢t judge or even begrudge the pike this ââ¬â it is merely doing what it is meant to do, and, Hughes would argue, that is just as it should be.
Thursday, August 1, 2019
Cash Basis vs. Accrual Basis Accounting Essay
Cash basis accounting and the accrual basis accounting are two accounting methods used to keep track of a businessââ¬â¢s income and expenses. In accrual basis accounting, revenue is recorded as it is earned and expenses are recorded when they generate revenue. Under cash basis accounting, only transactions involving increases or decreases of the entityââ¬â¢s cash are recorded. One of the major differences is the reporting of net income and net cash flows from operations. The cash basis is the more commonly used method of accounting by individuals and small businesses with sales of less than $5 million per year whereas accrual basis is used by large companies and is required of corporations whose stock is publicly traded. With accrual basis accounting being more complex, it provides more financial information about a company, therefore, providing more meaningful financial reports. Cash basis accounting is the simple method. It provides a more accurate picture of how much actual cash your business has because it only deals with cash transactions. Companies record transaction when they have an increase or decrease of cash. However, this doesnââ¬â¢t give you a clear picture of a companyââ¬â¢s operations and financial performance. In summary, the difference is the timing when transactions, including sales and purchases, are credited or debited to your account. If your business is simple, then cash basis will do, but accrual basis provides the ââ¬Å"bigâ⬠picture of business operations.
Subscribe to:
Posts (Atom)